Image Results
Video Results
No matches found.
Web Results
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | Next | Last
Exon - Wikipedia, the free encyclopedia (Search Map)
Article on regions in genes that are expressed in mature ... RNA splicing: intron/exon · snRNP · spliceosome (minor spliceosome, U1) · alternative splicing ...
exon: Definition from Answers.com (Search Map)
exon n. A sequence of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
3685 (Search Map)
USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
exon definition | Dictionary.com (Search Map)
Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Exon encyclopedia topics | Reference.com (Search Map)
Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... POEM, A 3-dimensional exon taxonomy and patterns in ...
Affymetrix - GeneChip® Mouse Exon 1.0 ST Array (Search Map)
GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
MYH7 exons, primers, and amplimers (Search Map)
MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
exon - definition of exon by the Free Online Dictionary, Thesaurus and ... (Search Map)
Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
CiteULike: Tag exon [56 articles] (Search Map)
Antisense-mediated exon skipping: A versatile tool with ... The effect of intron length on exon creation ratios during the evolution of mammalian genomes. ...
Affymetrix - GeneChip® Rat Exon 1.0 ST Array (Search Map)
GeneChip® Rat Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Transcript Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...